Jocelyn Castaenda,
Samantha Muniz,
Danielle Valerio.
EXPLORING MOLECULAR EVOLUTION
STUDENT WORKSHEE
Results of your pairwise alignment comparing the beta globin gene in humans and in chimps:
- Data about the alignment can be found below the blue/black alignment chart. How many nucleotides are there in the beta globin gene for:
- The chimp?
GGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGAC
CCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAG
GCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCT
TTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAA
CGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAG
AAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAAT
TTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGC
ATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC
- The human?
GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC
AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG
CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC
TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT
CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA
CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA
CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT
GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC
- A blue asterix indicates that the nucleotides in both sequences are the same, we say they are conserved. What percentage of the beta globin sequence is conserved in chimps and humans? (Don’t include the insertion at the beginning of the human gene). This percentage is often reported as a similarity “score” below the alignment.
99
- Would you expect the protein structure to be highly similar or markedly different in the chimp and the human? Explain.
We would expect it to be similar because, we have a lot of the same trades as chimps. Both of the human and chimp walk on two feet. And the theory of evolution would make us say it would be similar.
RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS
Results of your pairwise alignment comparing the beta globin gene in humans and in chickens:
- What is the percentage of sequence conservation between the beta globin gene in chickens and humans? Work this out using the second line of nucleotides only.
- Looking at the two pairwise alignments you have performed, would you expect the beta globin protein found in humans to be more similar to that found in chickens or that found in chimps? Explain.
We would expect the protein found in humans to be similar to chimps because the percentage of the “score” was 99% for chimps & humans. But for the chickens and humans it was only 57%.
- Do the results achieved by running these alignments support the results on evolutionary relationships determined by scientists using anatomical homology? Explain.
Yes, because chimps and humans are more relative then chickens and humans. The percentage was way off when it was chickens and humans. But the percentage for humans and chimps was close it was “99%”.
RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS
Results of your multiple sequence alignment comparing the beta globin gene in a variety of animal species:
- Examine the Unrooted Tree produced.
Record the species at the end of each branch on the unrooted tree shown below.
- Based on the information in the unrooted tree:
- Which two species appear to be most closely related to each other? Explain your choice.
- Which two species seem to be the least closely related to each other? Explain your choice.
- Comparative evolutionary distance between species is indicated by the length of the clades they are on. Give the comparative evolutionary distance (in mm) between:
- The mouse and human
79
- The wallaby and the human
- The chimp and the human
Comment on the significance of these results given your knowledge of mammalian groups.
RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS
Results of your Rooted Phylogenetic Tree:
- Examine your Rooted Phylogenetic Tree and record the species at the end of each branch.
- Based on this tree diagram, which species is/are most closely related to:
- The goldfish:
chicken
- The mouse:
Human
- Homology is a term used to refer to a feature in two or more species that is similar because of descent; it evolved from the same feature in the last common ancestor of the species. Hence, similarity in DNA or protein sequences between individuals of the same species or among different species is referred to as sequence homology. Which two species in the tree above share greatest homology with respect to the beta globin gene?
- A node is a branch point representing a divergence event from a common ancestor. Which two species have the most ancestral nodes (divergence events) in the tree above? Explain your answer giving the number of nodes leading to these species.
- Looking at the phylogentic tree above, which two organisms:
- Diverged from their common ancestor most recently?
- Diverged from their common ancestor least recently?
- Draw a modified phylogenetic tree to show how the tree above might change if the beta globin gene for a kangaroo was added to the multiple sequence alignment.
- It is important to understand that the phylogenetic trees you generated using bioinformatics tools are based on sequence data alone. While sequence relatedness can be very powerful as a predictor of the relatedness of species, other methods must be used in addition to sequence homology, to determine evolutionary relationships. Briefly describe 3 other methods that you think might be used to determine evolutionary relationships.
- GENES- Is used to determine the order of the base pairs in a segment of RNA or DNA
- DNA- The set of non-genetic traits, qualities, or features that characterize a person.
- Morphology- A branch of bio-science dealing with the study of the form and structure of organisms and their specific structural features.
No comments:
Post a Comment