Monday, May 7, 2012
Friday, May 4, 2012
Bio worksheet
Jocelyn Castaenda,
Samantha Muniz,
Danielle Valerio.
EXPLORING MOLECULAR EVOLUTION
STUDENT WORKSHEE
Results of your pairwise alignment comparing the beta globin gene in humans and in chimps:
- Data about the alignment can be found below the blue/black alignment chart. How many nucleotides are there in the beta globin gene for:
- The chimp?
GGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGAC
CCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAG
GCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCT
TTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAA
CGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAG
AAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAAT
TTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGC
ATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC
- The human?
GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC
AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG
CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC
TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT
CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA
CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA
CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT
GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC
- A blue asterix indicates that the nucleotides in both sequences are the same, we say they are conserved. What percentage of the beta globin sequence is conserved in chimps and humans? (Don’t include the insertion at the beginning of the human gene). This percentage is often reported as a similarity “score” below the alignment.
99
- Would you expect the protein structure to be highly similar or markedly different in the chimp and the human? Explain.
We would expect it to be similar because, we have a lot of the same trades as chimps. Both of the human and chimp walk on two feet. And the theory of evolution would make us say it would be similar.
RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS
Results of your pairwise alignment comparing the beta globin gene in humans and in chickens:
- What is the percentage of sequence conservation between the beta globin gene in chickens and humans? Work this out using the second line of nucleotides only.
- Looking at the two pairwise alignments you have performed, would you expect the beta globin protein found in humans to be more similar to that found in chickens or that found in chimps? Explain.
We would expect the protein found in humans to be similar to chimps because the percentage of the “score” was 99% for chimps & humans. But for the chickens and humans it was only 57%.
- Do the results achieved by running these alignments support the results on evolutionary relationships determined by scientists using anatomical homology? Explain.
Yes, because chimps and humans are more relative then chickens and humans. The percentage was way off when it was chickens and humans. But the percentage for humans and chimps was close it was “99%”.
RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS
Results of your multiple sequence alignment comparing the beta globin gene in a variety of animal species:
- Examine the Unrooted Tree produced.
Record the species at the end of each branch on the unrooted tree shown below.
- Based on the information in the unrooted tree:
- Which two species appear to be most closely related to each other? Explain your choice.
- Which two species seem to be the least closely related to each other? Explain your choice.
- Comparative evolutionary distance between species is indicated by the length of the clades they are on. Give the comparative evolutionary distance (in mm) between:
- The mouse and human
79
- The wallaby and the human
- The chimp and the human
Comment on the significance of these results given your knowledge of mammalian groups.
RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS
Results of your Rooted Phylogenetic Tree:
- Examine your Rooted Phylogenetic Tree and record the species at the end of each branch.
- Based on this tree diagram, which species is/are most closely related to:
- The goldfish:
chicken
- The mouse:
Human
- Homology is a term used to refer to a feature in two or more species that is similar because of descent; it evolved from the same feature in the last common ancestor of the species. Hence, similarity in DNA or protein sequences between individuals of the same species or among different species is referred to as sequence homology. Which two species in the tree above share greatest homology with respect to the beta globin gene?
- A node is a branch point representing a divergence event from a common ancestor. Which two species have the most ancestral nodes (divergence events) in the tree above? Explain your answer giving the number of nodes leading to these species.
- Looking at the phylogentic tree above, which two organisms:
- Diverged from their common ancestor most recently?
- Diverged from their common ancestor least recently?
- Draw a modified phylogenetic tree to show how the tree above might change if the beta globin gene for a kangaroo was added to the multiple sequence alignment.
- It is important to understand that the phylogenetic trees you generated using bioinformatics tools are based on sequence data alone. While sequence relatedness can be very powerful as a predictor of the relatedness of species, other methods must be used in addition to sequence homology, to determine evolutionary relationships. Briefly describe 3 other methods that you think might be used to determine evolutionary relationships.
- GENES- Is used to determine the order of the base pairs in a segment of RNA or DNA
- DNA- The set of non-genetic traits, qualities, or features that characterize a person.
- Morphology- A branch of bio-science dealing with the study of the form and structure of organisms and their specific structural features.
Wednesday, April 18, 2012
Tuesday, April 10, 2012
Monday, March 5, 2012
Monday, February 27, 2012
Friday, February 24, 2012
Friday, February 17, 2012
Eugenics
Eugenics
What is eugenics? Eugenics is the study of belief in the posibility of improving the qualities of the human species or a human population, ecspecially by discouraging reproduction by having gentic defects or inheritable undesirable traits or encouraging reproduction by inheritable desirable traits. American eugenics developed in the wake of turbulent economic and social problems following the civil war. Their was a rapid growth of American Industry, it increased mechaniztion of agriculture, created the first major migration awas from farms, and cities expanded. Starting in 1873, there were price fluctuations bankrupted many businesses and series of depressinons, this reoccured about every decade through the earlsy 1900's. Eugenicists argued that society paid a high price by allowing the birth of defective individuals who would have to be cared by the state. Sterilization of one defective adult could save future generations thousands of dollars. There was an increasing strength of militant labor unions and the rise of the American Socialist party ecspecially after the success of the Bolshevlk Revolution in 1917. Eugenics was seen as a way to solve all of these combined problems because it placed the cause in the defective germ plasm of individuals and ethnic groups an dnot in the structure of society itself. In an era troubled by rapid and seemingly chaotic change, eugenics offered the prospect of a planned, gradual, and smooth transition to a more harmonious future. Eugenics probide the biological counterpart to new theories of scientific contol and rational mangement in business. They emerged as scientists with a special expertise in the solution of perennal social problems. Eugenics provided what seemed to offer an objective, scientific approach to problems that previously had been cast almost wholly in subjective, humanitarian terms. Charity and state welfare had treated only symptoms, eugenics promised to attack social problems at their roots.
The scientific origins of eugenics movement was in the twentyith century as two wings of a common philosophy human warth. Francis Galton coined eugenics in 1883, percieved it as a moral philosophy to improve humanity by encouraging the ablest and eugenics is usually termed positive eugenics. Negative eugenics advocated culling the least able from the breeding population. United States, Germany, and Scandinovia favored the negative approach. Concerns about environmental influences that might damage heredity, leaading to ill health, early death isnanity, and defective off spring were formalized in the early 1700's as degeneracy theory. By the mid ninteenth century most scientises believed bad environments caused degenerate heredity. The Sociologist Richard Dugdale believed that good environments could tantsform degenerates into worthy citizens within three generations. At the beginning of the twentyith century, Welsmanns views were absorbed by degenracy theorists who embraced negative engenics as their favored model. Evolutionary models of natural selction and dysgenic hereditary practices in society also contributed to eugenic theory. There was fear that highly intelligent people would have smaller families while the allegedly degenerate elements of society were having larger families. Eugenics argued that "defectives" should be prevented from breeding, through custody in asylums or compulsory sterilization.
Research methods for eugenics became a popular movement in the United States, as its core was a research effort to apply Mendels laws to the inheritance of hyman traits. Eugenics researchers attempthed to trace the inheritance of a trait through a family tree or pedigree. In the beginning of the 1900's, Mendellan iinheritance was extended to other plants, to animals, and to humans. Mendal stated that each visisble trait is governed by a pair of genes. One member of each gene pair is inherited from the mother and one from the father. Genes may be dominant or recessive. Eugenics also used data pooled form inasaneasylums, prisons, orphanages, and homes for the blind. Superintendents were used to calculate the ethnic makeup of societal "dependants" and the costs of maintaining them in public institutions. Flaws in eugenics research displayed organizes in 1926 by the American Eugenics Society. Traits such as eye color, stature, and blood group are easy to define and measure. Eugenicists however were most interested in mental and behavior traits. Relfication is the tendancy to treat complex traits as if they were a single entity. They had poor survey and statistical methods. Conclusions were typically based by the manner in which was collected data. The institutional data was collected in 1921, during the peak of southern/eastern European immigration and primarily from the northeastern states where these populations were concentrated. False quantification is the assumption that if you can produce a umerical value then it must be a valid measure. IQ tests were accurate and culture-free measures of native intelligence, even though they contained questions that were dependent on cultural background and experience.
The eugenics research impact American Society by not really helping at all. By the mid 1930's eugenics research came under increasing scrutiny and independent analysis revealed thet most eugenic data were useless. The American Neurological Association reporthed that "invalidates we believe, the earlier work which comes from Davenport Rosanoff and the American Eugenics school with its headquartes at Cold Spring Harbor." Among other factors prompted the Carnegie Institution to withdraw its funding and permanetly close down the ERO in December 1939.
What is eugenics? Eugenics is the study of belief in the posibility of improving the qualities of the human species or a human population, ecspecially by discouraging reproduction by having gentic defects or inheritable undesirable traits or encouraging reproduction by inheritable desirable traits. American eugenics developed in the wake of turbulent economic and social problems following the civil war. Their was a rapid growth of American Industry, it increased mechaniztion of agriculture, created the first major migration awas from farms, and cities expanded. Starting in 1873, there were price fluctuations bankrupted many businesses and series of depressinons, this reoccured about every decade through the earlsy 1900's. Eugenicists argued that society paid a high price by allowing the birth of defective individuals who would have to be cared by the state. Sterilization of one defective adult could save future generations thousands of dollars. There was an increasing strength of militant labor unions and the rise of the American Socialist party ecspecially after the success of the Bolshevlk Revolution in 1917. Eugenics was seen as a way to solve all of these combined problems because it placed the cause in the defective germ plasm of individuals and ethnic groups an dnot in the structure of society itself. In an era troubled by rapid and seemingly chaotic change, eugenics offered the prospect of a planned, gradual, and smooth transition to a more harmonious future. Eugenics probide the biological counterpart to new theories of scientific contol and rational mangement in business. They emerged as scientists with a special expertise in the solution of perennal social problems. Eugenics provided what seemed to offer an objective, scientific approach to problems that previously had been cast almost wholly in subjective, humanitarian terms. Charity and state welfare had treated only symptoms, eugenics promised to attack social problems at their roots.
The scientific origins of eugenics movement was in the twentyith century as two wings of a common philosophy human warth. Francis Galton coined eugenics in 1883, percieved it as a moral philosophy to improve humanity by encouraging the ablest and eugenics is usually termed positive eugenics. Negative eugenics advocated culling the least able from the breeding population. United States, Germany, and Scandinovia favored the negative approach. Concerns about environmental influences that might damage heredity, leaading to ill health, early death isnanity, and defective off spring were formalized in the early 1700's as degeneracy theory. By the mid ninteenth century most scientises believed bad environments caused degenerate heredity. The Sociologist Richard Dugdale believed that good environments could tantsform degenerates into worthy citizens within three generations. At the beginning of the twentyith century, Welsmanns views were absorbed by degenracy theorists who embraced negative engenics as their favored model. Evolutionary models of natural selction and dysgenic hereditary practices in society also contributed to eugenic theory. There was fear that highly intelligent people would have smaller families while the allegedly degenerate elements of society were having larger families. Eugenics argued that "defectives" should be prevented from breeding, through custody in asylums or compulsory sterilization.
Research methods for eugenics became a popular movement in the United States, as its core was a research effort to apply Mendels laws to the inheritance of hyman traits. Eugenics researchers attempthed to trace the inheritance of a trait through a family tree or pedigree. In the beginning of the 1900's, Mendellan iinheritance was extended to other plants, to animals, and to humans. Mendal stated that each visisble trait is governed by a pair of genes. One member of each gene pair is inherited from the mother and one from the father. Genes may be dominant or recessive. Eugenics also used data pooled form inasaneasylums, prisons, orphanages, and homes for the blind. Superintendents were used to calculate the ethnic makeup of societal "dependants" and the costs of maintaining them in public institutions. Flaws in eugenics research displayed organizes in 1926 by the American Eugenics Society. Traits such as eye color, stature, and blood group are easy to define and measure. Eugenicists however were most interested in mental and behavior traits. Relfication is the tendancy to treat complex traits as if they were a single entity. They had poor survey and statistical methods. Conclusions were typically based by the manner in which was collected data. The institutional data was collected in 1921, during the peak of southern/eastern European immigration and primarily from the northeastern states where these populations were concentrated. False quantification is the assumption that if you can produce a umerical value then it must be a valid measure. IQ tests were accurate and culture-free measures of native intelligence, even though they contained questions that were dependent on cultural background and experience.
The eugenics research impact American Society by not really helping at all. By the mid 1930's eugenics research came under increasing scrutiny and independent analysis revealed thet most eugenic data were useless. The American Neurological Association reporthed that "invalidates we believe, the earlier work which comes from Davenport Rosanoff and the American Eugenics school with its headquartes at Cold Spring Harbor." Among other factors prompted the Carnegie Institution to withdraw its funding and permanetly close down the ERO in December 1939.
Thursday, February 9, 2012
Phases Of Mitosis In Plant And Animal Cells
All living organisms are made up of one or more cells. Cell have the ability to make identical copies of themselves by cell division. New cells are produced by existing cells, dividing cells are essential for the continuation of life. There are three varieties of reasons that cause cells to divide; multicellular organisms grow in size and complexity by making more cells, old and damaged cells are continuously replaced by the division of cells, and single-celled organisms such as bacteria divide to make new independent organisms. Two events are required for successful cell reproduction. The parent cell ensure that each new daughter cell receives a complete copy of its heredity information. This information is transmitted in the form of DNA and directs the various activities of the cell throughout its lifetime. The second requirement is the partitioning of cytoplasm between the two daughter cells.
Cell Cycle:
The cell cycle is known as the orderly program of events in the lifetime of a cell. The cell cycle is divided into two phases; mitotic phase which the cell divides its nuclear and cytoplasmic contents, and there are longer periods between divisions called interphase. The M stands for the mitotic phase which is the division of chromosomes and cytoplasm into two cells. During mitosis and cytokinesis the two daughter cells receive an exact copy of the parent cell's chromosomes and half of the cytoplasm. The parent cell chromosomes are replicated during the S (synthesis) phase of the cell cycle before mitosis can begin.
Phases Of Mitosis:
Prophase:
Prophase is the beginning of mitosis. In the beginning, the centrosomes move toward opposite poles of the cell and organized the spindle microtubules between them. The sister chromatids become visible in the nucleus as they condense.
Metaphase:
Metaphase is when the chromatids remain lined up between the poles of the cell.
Anaphase:
Anaphase is a pair of sister chromatids separate. Separated chromatids are called chromosomes and move toward the poles of the cell.
Telophase:
Telophase is the chromosomes that arrive at the poles and are the new nuclear membraned form around them.
Cytokinesis:
Cytokinesis is the division of the cytoplasmic components. For animal cells cytokinesis occurs when a ring of actin and myosin filaments constricts the plasma membrane at the equator. For plant cells, small vesicles fuse at the metaphase pate to form the cell plate.
Interphase:
Interphase is the process of mitosis and cytokinesis creates two separate cells. Each cell has an identical set of chromosomes.
Cell Cycle:
The cell cycle is known as the orderly program of events in the lifetime of a cell. The cell cycle is divided into two phases; mitotic phase which the cell divides its nuclear and cytoplasmic contents, and there are longer periods between divisions called interphase. The M stands for the mitotic phase which is the division of chromosomes and cytoplasm into two cells. During mitosis and cytokinesis the two daughter cells receive an exact copy of the parent cell's chromosomes and half of the cytoplasm. The parent cell chromosomes are replicated during the S (synthesis) phase of the cell cycle before mitosis can begin.
Phases Of Mitosis:
Prophase:
Prophase is the beginning of mitosis. In the beginning, the centrosomes move toward opposite poles of the cell and organized the spindle microtubules between them. The sister chromatids become visible in the nucleus as they condense.
Metaphase:
Metaphase is when the chromatids remain lined up between the poles of the cell.
Anaphase:
Anaphase is a pair of sister chromatids separate. Separated chromatids are called chromosomes and move toward the poles of the cell.
Telophase:
Telophase is the chromosomes that arrive at the poles and are the new nuclear membraned form around them.
Cytokinesis:
Cytokinesis is the division of the cytoplasmic components. For animal cells cytokinesis occurs when a ring of actin and myosin filaments constricts the plasma membrane at the equator. For plant cells, small vesicles fuse at the metaphase pate to form the cell plate.
Interphase:
Interphase is the process of mitosis and cytokinesis creates two separate cells. Each cell has an identical set of chromosomes.
Thursday, February 2, 2012
Stem Cells
DEFINITIONS
Cell-Based Therapies- Treatment in which stem cells are induced to differentiate into the specific cell type required to repair damaged or destroyed cells or tissues.
Differentiation- The process whereby an unspecialized embryonic cell acquires the features of a specialized cell such as a heart, liver, or muscle cell.
Embryonic Stem Cell Line- Embryonic stem cells, which have been cultured under conditions that allow proliferation without differentiatioon for months to years.
Proliferation- Expansion of the number of cells by the continuous division of single cells into two identical daughter cells.
Plasticity- The capability of being molded, receiving shape, or being made to assume a desired form.
Pluripotent- The state of a single cell that is capable of differentiating into all tissues of an organism, but not alone capable of sustaining full organismal development.
QUESTIONS
1.) What are the unique properties of all stem cells? Explain in your own words what each property means.
-Most stem cells are different from one another because of the body cells, but one thing that they all have in common is that they are able to divide and renew themselves for a long period, stem cells are unspecialized, and lastly they can rise to special cell types.
2.) What are the two main kinds of stem cells used by researchers? What are the major differences between the two types in terms of their sources and usefulness to researchers? Give examples for each type of stem cell.
-The two main kinds of stem cells they use are embryonic stem cells and non-embryonic stem cells.
-The differences are that embryonic stem cells are primitive cells that are derived from preimplantation and are known to develop into cells and tissues of the three primary germ layers and non-embryonic stem cells are already grown and cant develop into cells and tissues.
3.) List some of the diseases that scientists think may be treated using stem cell research and suggest how stem cells might be used to treat each disease.
-Parkinson's Disease
-Heart Disease
-Diabetes
-Arthritis
-Scientists think that the pluripotent stem cell will offer the possibility of replacing cells and tissues to treat these diseases.
4.) What are the necessary characteristics that laboratory-manipulated stem cells will need to have in order to be successfully used in cell-based therapies?
-There are alot of levels the stem cells go through to become succesful but the first one is the most important because if it doesn't go through the first level then it will never make it to the other levels and the first level is growing and subculturing the stem cells for many months. This ensures that the cells are capable of longh term growth and self renewal.
Cell-Based Therapies- Treatment in which stem cells are induced to differentiate into the specific cell type required to repair damaged or destroyed cells or tissues.
Differentiation- The process whereby an unspecialized embryonic cell acquires the features of a specialized cell such as a heart, liver, or muscle cell.
Embryonic Stem Cell Line- Embryonic stem cells, which have been cultured under conditions that allow proliferation without differentiatioon for months to years.
Proliferation- Expansion of the number of cells by the continuous division of single cells into two identical daughter cells.
Plasticity- The capability of being molded, receiving shape, or being made to assume a desired form.
Pluripotent- The state of a single cell that is capable of differentiating into all tissues of an organism, but not alone capable of sustaining full organismal development.
QUESTIONS
1.) What are the unique properties of all stem cells? Explain in your own words what each property means.
-Most stem cells are different from one another because of the body cells, but one thing that they all have in common is that they are able to divide and renew themselves for a long period, stem cells are unspecialized, and lastly they can rise to special cell types.
2.) What are the two main kinds of stem cells used by researchers? What are the major differences between the two types in terms of their sources and usefulness to researchers? Give examples for each type of stem cell.
-The two main kinds of stem cells they use are embryonic stem cells and non-embryonic stem cells.
-The differences are that embryonic stem cells are primitive cells that are derived from preimplantation and are known to develop into cells and tissues of the three primary germ layers and non-embryonic stem cells are already grown and cant develop into cells and tissues.
3.) List some of the diseases that scientists think may be treated using stem cell research and suggest how stem cells might be used to treat each disease.
-Parkinson's Disease
-Heart Disease
-Diabetes
-Arthritis
-Scientists think that the pluripotent stem cell will offer the possibility of replacing cells and tissues to treat these diseases.
4.) What are the necessary characteristics that laboratory-manipulated stem cells will need to have in order to be successfully used in cell-based therapies?
-There are alot of levels the stem cells go through to become succesful but the first one is the most important because if it doesn't go through the first level then it will never make it to the other levels and the first level is growing and subculturing the stem cells for many months. This ensures that the cells are capable of longh term growth and self renewal.
Subscribe to:
Posts (Atom)